Official Store Link: Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt
- Material: 100% combed ring-spun cotton
- Print Tech: High-resolution DTG print finish
- Style: Perfect casual streetwear aesthetic.
| "Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link" | |
| "k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Ruminococcaceae"," g__"," s__",0.203926138400861,0.0318117976483224,"TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG","http://dbbact.org/search_results?sequence=TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG" | |
| "k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.0743994263176766,0.0402549997237974,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAAC |
| # Verification image for the OSV-SCALIBR "erlang/rebarlock" software inventory extractor. | |
| # | |
| # Approved PRP issue : https://github.com/google/osv-scalibr/issues/1952 | |
| # Pull request : https://github.com/google/osv-scalibr/pull/2404 | |
| # Distribution method: rebar3 / rebar.lock (Hex package manager for Erlang/OTP) | |
| # OSV ecosystems : Hex, plus GIT for git-pinned dependencies | |
| # | |
| # This image does NOT copy in a test fixture. It runs rebar3 itself so that the | |
| # rebar.lock inside the image is genuinely produced by the build tool, and it is | |
| # chosen to cover all three cases the extractor handles: |
| hairbook-embed public deploy chunks |
| {"targetLanguage":"Vietnamese","translatorName":"Google","translatorModel":"Google","date":"2026-09-08 12:05:47","translationCount":0} |
| # Utility DCTLS | |
| These are DCTLs that I have developed. | |
| Support me at: [https://www.buymeacoffee.com/thatcherfreeman](https://www.buymeacoffee.com/thatcherfreeman) | |
| ## FAQ | |
| **Are you selling X dctl on Y website?** | |
| If you see these DCTLs for sale elsewhere on the internet, that is not me and I get none of that money if you choose to buy from them. |
| [ | |
| { | |
| "practice": "Use resource nouns in paths and let HTTP methods express the action.", | |
| "category": "url-design", | |
| "good_example": "GET /users/123", | |
| "bad_example": "GET /getUser?id=123", | |
| "rationale": "Resource-oriented paths make APIs predictable because the verb is already carried by the HTTP method.", | |
| "http_methods_involved": ["GET", "POST", "PUT", "PATCH", "DELETE"], | |
| "references": ["RFC 9110 HTTP Semantics", "Roy Fielding REST dissertation"] | |
| }, |
| Log uploaded on Tuesday, September 8, 2026, 2:03:49 PM | |
| Loaded mods: | |
| Prepatcher(zetrith.prepatcher): 0Harmony(2.4.2), 0PrepatcherAPI(1.2.0), 0PrepatcherDataAssembly(1.0.0), PrepatcherImpl(1.0.0), Prestarter(1.0.0) | |
| Harmony(brrainz.harmony)[v:2.4.2.0][mv:2.4.2.0]: 0Harmony(av:2.4.2,fv:2.4.1), HarmonyMod(2.4.2) | |
| Loading Progress(ilyvion.LoadingProgress)[v:0.14.0]: ilyvion.LoadingProgress(0.14.0) | |
| Core(Ludeon.RimWorld): (no assemblies) | |
| Royalty(Ludeon.RimWorld.Royalty): (no assemblies) | |
| Ideology(Ludeon.RimWorld.Ideology): (no assemblies) | |
| Biotech(Ludeon.RimWorld.Biotech): (no assemblies) | |
| Anomaly(Ludeon.RimWorld.Anomaly): (no assemblies) |
| 7db25178fe08ac91823adf3bf56e2d00da4a59dc62f4970faae2e2ca4730602c @ 1788843829.047188 |
| 7db25178fe08ac91823adf3bf56e2d00da4a59dc62f4970faae2e2ca4730602c @ 1788843827.7933168 |
Official Store Link: Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt