Skip to content

Instantly share code, notes, and snippets.

@baobabprince
baobabprince / DB39.138_microbiome_data.csv
Created September 8, 2026 05:07
Microbiome data for sample: DB39.138 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
"k__Bacteria"," p__Firmicutes"," c__Clostridia"," o__Clostridiales"," f__Ruminococcaceae"," g__"," s__",0.203926138400861,0.0318117976483224,"TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG","http://dbbact.org/search_results?sequence=TACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.0743994263176766,0.0402549997237974,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAAC
@Amsamms
Amsamms / Dockerfile
Created September 8, 2026 05:06
Verification testbed (Dockerfile) for the OSV-SCALIBR erlang/rebarlock inventory extractor - google/osv-scalibr#1952
# Verification image for the OSV-SCALIBR "erlang/rebarlock" software inventory extractor.
#
# Approved PRP issue : https://github.com/google/osv-scalibr/issues/1952
# Pull request : https://github.com/google/osv-scalibr/pull/2404
# Distribution method: rebar3 / rebar.lock (Hex package manager for Erlang/OTP)
# OSV ecosystems : Hex, plus GIT for git-pinned dependencies
#
# This image does NOT copy in a test fixture. It runs rebar3 itself so that the
# rebar.lock inside the image is genuinely produced by the build tool, and it is
# chosen to cover all three cases the extractor handles:
@aileron
aileron / readme.txt
Created September 8, 2026 05:06
hairbook-embed public deploy chunks
hairbook-embed public deploy chunks
@csh1668
csh1668 / metadata.json
Created September 8, 2026 05:05
RimWorld AutoTranslation Cache - Vietnamese (Google)
{"targetLanguage":"Vietnamese","translatorName":"Google","translatorModel":"Google","date":"2026-09-08 12:05:47","translationCount":0}
# Utility DCTLS
These are DCTLs that I have developed.
Support me at: [https://www.buymeacoffee.com/thatcherfreeman](https://www.buymeacoffee.com/thatcherfreeman)
## FAQ
**Are you selling X dctl on Y website?**
If you see these DCTLs for sale elsewhere on the internet, that is not me and I get none of that money if you choose to buy from them.
@Anthgg
Anthgg / rest_best_practices.json
Created September 8, 2026 05:05
BountyBook rest_best_practices.json deliverable
[
{
"practice": "Use resource nouns in paths and let HTTP methods express the action.",
"category": "url-design",
"good_example": "GET /users/123",
"bad_example": "GET /getUser?id=123",
"rationale": "Resource-oriented paths make APIs predictable because the verb is already carried by the HTTP method.",
"http_methods_involved": ["GET", "POST", "PUT", "PATCH", "DELETE"],
"references": ["RFC 9110 HTTP Semantics", "Roy Fielding REST dissertation"]
},
@HugsLibRecordKeeper
HugsLibRecordKeeper / output_log.txt
Created September 8, 2026 05:03
Rimworld output log published using HugsLib Standalone Log Publisher
Log uploaded on Tuesday, September 8, 2026, 2:03:49 PM
Loaded mods:
Prepatcher(zetrith.prepatcher): 0Harmony(2.4.2), 0PrepatcherAPI(1.2.0), 0PrepatcherDataAssembly(1.0.0), PrepatcherImpl(1.0.0), Prestarter(1.0.0)
Harmony(brrainz.harmony)[v:2.4.2.0][mv:2.4.2.0]: 0Harmony(av:2.4.2,fv:2.4.1), HarmonyMod(2.4.2)
Loading Progress(ilyvion.LoadingProgress)[v:0.14.0]: ilyvion.LoadingProgress(0.14.0)
Core(Ludeon.RimWorld): (no assemblies)
Royalty(Ludeon.RimWorld.Royalty): (no assemblies)
Ideology(Ludeon.RimWorld.Ideology): (no assemblies)
Biotech(Ludeon.RimWorld.Biotech): (no assemblies)
Anomaly(Ludeon.RimWorld.Anomaly): (no assemblies)
7db25178fe08ac91823adf3bf56e2d00da4a59dc62f4970faae2e2ca4730602c @ 1788843829.047188
7db25178fe08ac91823adf3bf56e2d00da4a59dc62f4970faae2e2ca4730602c @ 1788843827.7933168
@namdung2208-collab
namdung2208-collab / Spongebob_Squarepants_The_Hash.md
Created September 8, 2026 05:03
Product Guide: Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt

Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt - Premium Graphic Apparel

Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt

Official Store Link: Spongebob Squarepants The Hash Slinging Slasher Spooky T Shirt

Features:

  • Material: 100% combed ring-spun cotton
  • Print Tech: High-resolution DTG print finish
  • Style: Perfect casual streetwear aesthetic.